Статья:

Анализ ассоциации генов рецепторов серотонина HTR1A и HTR2C с показателями концентрации внимания

Конференция: XXXIX Студенческая международная заочная научно-практическая конференция «Молодежный научный форум: естественные и медицинские науки»

Секция: Биология

Выходные данные
Камалов А.М., Садыкова Л.Р. Анализ ассоциации генов рецепторов серотонина HTR1A и HTR2C с показателями концентрации внимания // Молодежный научный форум: Естественные и медицинские науки: электр. сб. ст. по мат. XXXIX междунар. студ. науч.-практ. конф. № 10(38). URL: https://nauchforum.ru/archive/MNF_nature/10(38).pdf (дата обращения: 19.08.2018)
Лауреаты определены. Конференция завершена
Эта статья набрала 1 голос
Мне нравится
Дипломы
лауреатов
Сертификаты
участников
Дипломы
лауреатов
Сертификаты
участников
на печатьскачать .pdfподелиться

Анализ ассоциации генов рецепторов серотонина HTR1A и HTR2C с показателями концентрации внимания

Камалов Айнур Мирзаевич
магистрант БГПУ им. М. Акмуллы, РФ, Республика Башкортостан, г. Уфа
Садыкова Лиана Рафаэлевна
магистрант БГПУ им. М. Акмуллы, РФ, Республика Башкортостан, г. Уфа
Гумерова Оксана Владимировна
научный руководитель, канд. биол. наук, доц. БГПУ им. М. Акмуллы, РФ, Республика Башкортостан, г. Уфа

 

Проведен анализ показателей концентрации внимания в выборке студентов 1–4 курсов. При изучении распределения показателей внимания в зависимости от года обучения установлено, что самые высокие значения характерны для студентов 3 курса (в среднем 19,59 баллов), а самые низкие для 1 курса (в среднем 17,94 балла). Среднее значение по выборке соответствовало нормальному уровню концентрации внимания (18,8 баллов). Изучено распределение частот генотипов и аллелей полиморфных локусов генов рецепторов серотонина HTR1A (C(-1019)G) и HTR2C (G68C) в исследованной выборке, и проведен анализ полиморфных вариантов данных генов с уровнем концентрации внимания.

Введение

Внимание – одна из ключевых когнитивных характеристик, определяющая организацию всей познавательной деятельности. Внимание представляет собой избирательный процесс восприятия одной информации (наиболее важной) и игнорирования другой (менее важной). Оно играет ведущую роль в восприятии и сборе информации.

Показано, что развитие признака «внимание» в значительной мере обусловлено генетическими факторами. По данным близнецовых исследований, вклад генотипа в становлении данного признака составляет 89% [6, c. 269]. В настоящее время открыто множество генетических маркеров, ассоциированных с различными показателями развития уровня внимания. К числу таких маркеров относятся гены, продукты которых участвуют в метаболизме, передачи, рецепции нейромедиаторов (серотонин, дофамин, ацетилхолин и др.). Так, накоплен ряд данных о связи генов серотонинергической системы со сниженным уровнем внимания [2, c. 613; 7; 5, с. 460; 3, с. 1].

Одними из ключевых генов, определяющих нейромедиаторную передачу, являются гены рецепторов серотонина. Рецептор серотонина типа 1А является продуктом гена HTR1A, и расположен на 5-й хромосоме. Рецепторы данного типа располагаются на пресинаптической мембране. Один из полиморфных локусов C(-1019)G обусловлен заменой цитозина на гуанин в промоторной области гена в положении -1019. Данная мутация приводит к усилению экспрессии гена. В результате увеличивается плотность рецепторов типа 1А на пресинаптической мембране, что ведет к ингибированию синтеза серотонина в нервных окончаниях [9].

Ген рецептора серетонина типа 2С (HTR2C) локализован на Х-хромосоме. Продукт гена участвует в рецепции серотонина на постсинаптической мембране. Одним из наиболее изученных полиморфизмов является G68C. Замена гуанина на цитозин в 68 – м положении приводит к замене аминокислоты цистеина на серин в полипетидной цепочке. На молекулярном уровне это приводит к изменению конформационной структуры белка. В результате рецептор становится менее чувствительным к молекуле серотонина [8].

Целью данного исследования являлся анализ ассоциации полиморфных вариантов генов рецепторов серотонина (HTR1A и HTR2C) с уровнем концентрации внимания.

Материалы и методы

Объем выборки составил 122 человека в возрасте от 18 до 23 лет. Исследование проводилось с добровольного письменного согласия испытуемых.

Тестирование внимания. Испытуемые проходили тест Рисса на определение концентрации внимания [1, c. 92]. Бланк представлял собой набор из 25 пронумерованных перепутанных линий. По инструкции испытуемый должен был найти концы всех линий за 7 минут. При этом траекторию каждой линии необходимо было отслеживать только взглядом. Нормой считалось правильное прохождение от 15 до 18 линий. Низкий результат находился в пределах от 1 до 14 правильно пройденных линий. Высокий результат соответствовал границе от 19 до 25 успешно пройденных линий. Для упрощения интерпретации результатов каждая успешно пройденная линия была представлена как 1 балл.

Молекулярно–генетические методы исследования. Выделение ДНК из венозной крови проводили стандартным методом фенольно-хлороформной экстракции [4, c. 32].

Для амплификации полиморфных локусов использовали следующие праймеры (табл. 1):

Таблица 1.

Последовательность праймеров для амплификации

Ген/полиморфизм

Последовательность праймера

HTR1A C(-1019)G

5 – GGCTGGACT GTTAGATGATAACG – 3

5 – GGAAGAAG CCGAGTGTGTCAT - 3

HTR2C G68C

5 – TTGGCCTATTGGTTTGGGAAT – 3

5 – GTCTGGGAATTTGAAGCGTCCAC – 3

 

Амплификация изученных локусов проводилась на амплификаторе «Терцик» по следующим программам (табл. 2):

Таблица 2.

Программа амплификации генов HTR1A и HTR2C

Ген (полиморфизм)

Программа амплификации

HTR1A (C(-1019)G)

          

1.    95оC  – 5 мин. – 1 цикл

 

2.    95оC – 45 сек.

61оC- 1 мин. 35 циклов

72оC - 1 мин.

 

3.    72оC – 7мин. – 1 цикл

 

HTR2C (G68C)

1.    94оC – 4 мин. – 1 цикл

 

2.    94оC – 45 сек.

57оC -–45 сек. 30 циклов

72оC – 45 сек

3.    72оC - 10 мин – 1 цикл

 

 

Последующий ПДРФ-анализ проводили при помощи рестриктаз BseGI (для гена HTR1A) и HinfI (для гена HTR2C). Инкубировали 16 часов при 37˚.

Разделение фрагментов проводили в 7% полиакриламидном геле.

Статистическая обработка. Статистическая обработка данных проводилась с помощью однофакторного дисперсионного анализа (ANOVA) в программе Statistica 6.0.

Результаты и обсуждения

Средний балл по тесту Рисса по выборке составил 18,8 балла. Испытуемые с высокими показателями концентрации внимания (>18 баллов) встречались с частотой 62,3%; со средними (15–18 баллов) – 24,59%; с низкими (< 15 баллов) – 13,11%.

Также был проведен анализ значений концентрации внимания в зависимости от года обучения. Всего было проанализировано 4 курса. Первый курс в среднем имел 17,94 балла за тест. В данной группе показатели концентрации внимания имели следующие частоты: высокий показатель – 52,78%; средний показатель – 30,55%; низкий показатель – 16,67%. Второй курс характеризовался средним баллом равный 18,54. Частоты высоких, средних, низких показателей внимания распределились следующим образом: 62,5%; 16,67%; 20,83% соответственно. Третий курс имел средний балл равный 19,59. Распределение частот показателей внимания в данной группе выглядело следующим образом: высокий показатель – 63,64%; средний показатель – 27,27%; низкий показатель – 9,09%. Средний балл за тест в четвертом курсе составил 18,96. В данной группе показатели концентрации внимания имели следующие частоты: высокий показатель – 65,63%; средний показатель – 25%; низкий показатель –9,37%.

При генотипировании полиморфного локуса C(-1019)G гена HTR1A было установлено наличие двух аллелей (*C и *G) и трех генотипов (*G/*G, *C/*G, *C/*C).Частота данных генотипов в исследованной выборке составила: *G/*G32,83%, *C/*G 43,28%, *C/*C23,88%. Аллели встречались с частотой 54,48% (аллель *C) и 45,52% (аллель *G) соответственно.

При генотипировании полиморфного локуса G68C гена HTR было установлено наличие двух аллелей (*C и *G) и трех генотипов (*G/*G, *C/*G, *C/*C). Поскольку данный ген находится на X – хромосоме, то выборки мужчин и женщин анализировались отдельно. По причине немногочисленности мужская выборка не была включена в исследование. В группе женщин генотипы распределились следующим образом: *G/*G – 87,3%, *C/*G – 9,52%, *C/*C3,17%. Аллели встречались со следующей частотой: *C7, 94%, *G92,06%.

Для определения связи между показателями концентрации внимания и полиморфными вариантами исследуемых генов был проведен однофакторный дисперсионный анализ, где в качестве независимого фактора выступал генотип, а показатели концентрации внимания были представлены как зависимый фактор. Данные показаны в таблице 3:

Таблица 3.

Результаты анализа ассоциации генов HTR1A и HTR2C с показателями концентрации внимания

Ген/полиморфизм

Стандартное отклонение

F

p

HTR1A /C(-1019)G

3,71

1,68

0,19

HTR2C /G68C

3,32

1,05

0,35

*p – уровень значимости (p<0,05); F – критерий Фишера

 

Графическое представление результатов однофакторного дисперсионного анализа ANOVA полиморфных вариантов C(-1019)G по гену HTR1A с уровнем концентрации внимания представлено на рис. 1.

 

Рисунок 1: График распределения генотипов гена HTR1A в зависимости от показателей концентрации внимания

 

Из представленного графика следует, что наиболее высокие значения уровня концентрации внимания характерны для носителей гетерозиготного генотипа HTR1A*C/*G. Среднее значение в данной группе составляет 20,5 баллов, что соответствует высокому уровню концентрации внимания. Для групп с генотипами HTR1A*C/*C и HTR1A*G/*G средние значения показателей составляли 19 и 18,6 баллов соответственно. Уровень значимости превышал допустимую вероятность (F =1,68; Р=0,19).

На рис.2 отображена зависимость показателей концентрации внимания от полиморфных вариантов гена рецептора серотонина HTR2С.

 

Рисунок 2. График распределения генотипов по гену HTR2С с показателями уровня концентрации внимания

 

Из представленного графика следует, что наиболее высокие значения уровня концентрации внимания характерны для носителей аллеля HTR2C*G: в группе носителей генотипа HTR*G/*C средний показатель составляет 20 баллов, а у носителей генотипа HTR*G/*G – 19,8 баллов. Наименьшее значение показателей уровня концентрации внимания характерно для генотипа HTR*C/*C (16,8 баллов). Уровень значимости в данном случае также превышал допустимое значение (F= 1,05; Р= 0,35).

Таким образом, не было выявлено статистически значимых ассоциаций полиморфных локусов генов HTR1A и HTR2C с уровнем концентрации внимания.

Вывод

В рамках данной работы не было выявлено ассоциаций полиморфных локусов генов HTR2C (G68C) и HTR1A (C(-1019)G) с определенным уровнем концентрации внимания.

 

Список литературы:
1. Бруннер Е.Ю. Лучше, чем супервнимание: Методики диагностики и психокоррекции — Ростов н/Д: Феникс, 2006. – 316 с.
2. Caylak E. Biochemical and genetic analyses of childhood attention deficit / hyperactivity disorder // American Journal of Medical Genetics Part B: Neuropsychiatric Genetics. – 2012. – Т. 159. – № 6. – С. 613–627.
3. Hawi Z. et al. The molecular genetic architecture of attention deficit hyperactivity disorder // Molecular psychiatry. – 2015. – С. 1–9.
4. Mathew C.C. The isolation of high molecular weight eucariotic DNA // Methods in Molecular Biology // Ed. Walker J.M.N. Y.: Human Press. 1984. V. 2. P. 31–34
5. Smoller J.W. et al. Association between the 5HT1B receptor gene (HTR1B) and the inattentive subtype of ADHD // Biological psychiatry. – 2006. – Т. 59. – № 5. – С. 460–467.
6. Torgersen A.M. Genetic and environmental influences on temperament development: Longitudinal study of twins from infancy to adolescence // Early influences shaping the individual. – Springer US, 1989. – С. 269–281. 
7. Xu X. et al. Investigation of the serotonin 2C receptor gene in attention deficit hyperactivity disorder in UK samples // BMC research notes: сайт. – URL: http://bmcresnotes.biomedcentral.com/articles/10.1186/1756-0500-2-71 (Дата обращения 18.10.2016).
8. База данных человеческих генов – [Электронный ресурс] – Режим доступа: http://www.genecards.org/cgi-bin/carddisp.pl?gene=HTR2C (Дата обращения 17.10.2016).
9. База данных человеческих генов – [Электронный ресурс] – Режим доступа: http://www.genecards.org/cgi-bin/carddisp.pl?gene=HTR1A (Дата обращения 17.10.2016).